ID: 1042246393_1042246406

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1042246393 1042246406
Species Human (GRCh38) Human (GRCh38)
Location 8:66712761-66712783 8:66712812-66712834
Sequence CCTGCCGGGAAGGAGGAAGCGCA GGGAGCAGCACCGCGGGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 156} {0: 1, 1: 0, 2: 1, 3: 34, 4: 359}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!