ID: 1042252992_1042252998

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1042252992 1042252998
Species Human (GRCh38) Human (GRCh38)
Location 8:66775141-66775163 8:66775156-66775178
Sequence CCGGTGGTGATTGGTGAGGGCGG GAGGGCGGGGCCTGCCGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 9, 4: 180} {0: 1, 1: 1, 2: 0, 3: 59, 4: 567}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!