ID: 1042346831_1042346835

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1042346831 1042346835
Species Human (GRCh38) Human (GRCh38)
Location 8:67736146-67736168 8:67736167-67736189
Sequence CCTGACTCCATCTCACTTTCCTG TGTGGTCTTTCCTTTATCACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 40, 4: 513} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!