ID: 1042351057_1042351064

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1042351057 1042351064
Species Human (GRCh38) Human (GRCh38)
Location 8:67778113-67778135 8:67778152-67778174
Sequence CCAGCATCACACCATCCAATAGG TAAACAATAGGACGCATTTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!