ID: 1042449972_1042449976

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1042449972 1042449976
Species Human (GRCh38) Human (GRCh38)
Location 8:68932818-68932840 8:68932843-68932865
Sequence CCAATGAGCCAAACCAATTGATT CTTTGTATCATCGATGCAACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 238} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!