ID: 1042460310_1042460312

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1042460310 1042460312
Species Human (GRCh38) Human (GRCh38)
Location 8:69058139-69058161 8:69058157-69058179
Sequence CCTGGTCACCATTGGTGCAATAT AATATTTAGCACTTTGTGCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!