ID: 1042560487_1042560496

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1042560487 1042560496
Species Human (GRCh38) Human (GRCh38)
Location 8:70069868-70069890 8:70069912-70069934
Sequence CCGCACGCTCGGCGGCTCTGCAG CACCGCGCGGGAGCTTCCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 113} {0: 1, 1: 0, 2: 0, 3: 5, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!