ID: 1042560500_1042560515

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1042560500 1042560515
Species Human (GRCh38) Human (GRCh38)
Location 8:70069936-70069958 8:70069969-70069991
Sequence CCGACCCGCGCCTCCCCACCAGC CCAGCCAGCCCCAGATCCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 56, 4: 836} {0: 1, 1: 0, 2: 2, 3: 26, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!