ID: 1042560890_1042560896

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1042560890 1042560896
Species Human (GRCh38) Human (GRCh38)
Location 8:70071446-70071468 8:70071469-70071491
Sequence CCTCCCTGGGACCCTAGTGGCGA GCACTCGCCGCTGGCCTTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 71} {0: 1, 1: 0, 2: 0, 3: 8, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!