ID: 1042593795_1042593798

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1042593795 1042593798
Species Human (GRCh38) Human (GRCh38)
Location 8:70424145-70424167 8:70424163-70424185
Sequence CCATAGTATGGCCACAGTGGCCA GGCCAGTGGTCTTAATGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 97} {0: 1, 1: 0, 2: 5, 3: 13, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!