ID: 1042683662_1042683666

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1042683662 1042683666
Species Human (GRCh38) Human (GRCh38)
Location 8:71414085-71414107 8:71414107-71414129
Sequence CCAGAGGGAAGGCCCTACATAGT TTATCCTGAGTAGGAGCTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 64} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!