ID: 1042704844_1042704853

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1042704844 1042704853
Species Human (GRCh38) Human (GRCh38)
Location 8:71655206-71655228 8:71655252-71655274
Sequence CCCAAAGTGCTGTGATTACAGGC TCTGCTGTTCTTGAGCTGAGAGG
Strand - +
Off-target summary {0: 1763, 1: 231601, 2: 276763, 3: 181923, 4: 140363} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!