ID: 1042741374_1042741375

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1042741374 1042741375
Species Human (GRCh38) Human (GRCh38)
Location 8:72050912-72050934 8:72050935-72050957
Sequence CCTTCTGTTCTGTACAACAGCTG AAACTCAAGATTATTTCTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 163} {0: 1, 1: 1, 2: 5, 3: 51, 4: 476}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!