ID: 1042756796_1042756802

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1042756796 1042756802
Species Human (GRCh38) Human (GRCh38)
Location 8:72223126-72223148 8:72223159-72223181
Sequence CCAGGAGCTCCTGGGGCTTCTGG CTGCAGAACTTGAGGGTAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 21, 3: 79, 4: 665} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!