ID: 1042764741_1042764754

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1042764741 1042764754
Species Human (GRCh38) Human (GRCh38)
Location 8:72308739-72308761 8:72308775-72308797
Sequence CCAGTGACCATTCATACATTCAC GGGGTGTGGGGAGCAGGGTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 35, 3: 441, 4: 3210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!