ID: 1042808778_1042808782

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1042808778 1042808782
Species Human (GRCh38) Human (GRCh38)
Location 8:72801085-72801107 8:72801114-72801136
Sequence CCCCACTCCAGGGAACATAATGC AACCCCTGTTAGACCTTGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 150} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!