ID: 1042821765_1042821769

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1042821765 1042821769
Species Human (GRCh38) Human (GRCh38)
Location 8:72937259-72937281 8:72937274-72937296
Sequence CCGACCTCCCAGGGACAGAAGAG CAGAAGAGCACCAAAGAGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 44, 4: 485} {0: 1, 1: 0, 2: 0, 3: 22, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!