ID: 1042837199_1042837207

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1042837199 1042837207
Species Human (GRCh38) Human (GRCh38)
Location 8:73089872-73089894 8:73089897-73089919
Sequence CCCTGCCCCTACTTTTTTTTGAG AGGGTCTTACTCTGTGGCCCAGG
Strand - +
Off-target summary No data {0: 26, 1: 1122, 2: 15225, 3: 75752, 4: 182488}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!