ID: 1042859045_1042859050

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1042859045 1042859050
Species Human (GRCh38) Human (GRCh38)
Location 8:73295040-73295062 8:73295054-73295076
Sequence CCGAGCCGGGTGACTGCCGCGGC TGCCGCGGCGGGCACAGTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 84} {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!