ID: 1042885949_1042885956

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1042885949 1042885956
Species Human (GRCh38) Human (GRCh38)
Location 8:73552027-73552049 8:73552055-73552077
Sequence CCTTGCTAAATATTCCAGTTGTT GGTTGTACTGGAGAACAAGGGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 20, 4: 240} {0: 2, 1: 0, 2: 1, 3: 15, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!