ID: 1042897030_1042897037

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1042897030 1042897037
Species Human (GRCh38) Human (GRCh38)
Location 8:73681706-73681728 8:73681751-73681773
Sequence CCAAGTATCTGCTGTTTTCAAGG TCACATAAACTGAAGGTAAAGGG
Strand - +
Off-target summary {0: 2, 1: 11, 2: 164, 3: 332, 4: 815} {0: 5, 1: 338, 2: 491, 3: 463, 4: 993}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!