|
Left Crispr |
Right Crispr |
| Crispr ID |
1042897030 |
1042897037 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
8:73681706-73681728
|
8:73681751-73681773
|
| Sequence |
CCAAGTATCTGCTGTTTTCAAGG |
TCACATAAACTGAAGGTAAAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 11, 2: 164, 3: 332, 4: 815} |
{0: 5, 1: 338, 2: 491, 3: 463, 4: 993} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|