|
Left Crispr |
Right Crispr |
Crispr ID |
1042897034 |
1042897037 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
8:73681735-73681757
|
8:73681751-73681773
|
Sequence |
CCTAACACATAAGGACTCACATA |
TCACATAAACTGAAGGTAAAGGG |
Strand |
- |
+ |
Off-target summary |
{0: 349, 1: 430, 2: 380, 3: 255, 4: 362} |
{0: 5, 1: 338, 2: 491, 3: 463, 4: 993} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|