ID: 1042926579_1042926589

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1042926579 1042926589
Species Human (GRCh38) Human (GRCh38)
Location 8:73973547-73973569 8:73973598-73973620
Sequence CCCCTGAGTAGCTGGGATTACGG TTCTGTGTTTTTAGTGAAGACGG
Strand - +
Off-target summary {0: 14, 1: 1312, 2: 3693, 3: 5903, 4: 7158} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!