ID: 1042930533_1042930535

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1042930533 1042930535
Species Human (GRCh38) Human (GRCh38)
Location 8:74008903-74008925 8:74008922-74008944
Sequence CCTGGAAGGGAGTGGTTGCACCA ACCAACACCAAAGAAGGTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 61, 4: 937} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!