ID: 1042942123_1042942133

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1042942123 1042942133
Species Human (GRCh38) Human (GRCh38)
Location 8:74118381-74118403 8:74118407-74118429
Sequence CCTTCTTCCCTCTCTCCCCACCT TCCCTCCAGTGGCGCAATCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 43, 4: 3406}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!