ID: 1042952846_1042952850

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1042952846 1042952850
Species Human (GRCh38) Human (GRCh38)
Location 8:74219522-74219544 8:74219555-74219577
Sequence CCATGAAAAGAGAAATGCTGTAA TAATATATGCACAGGGTGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 383} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!