ID: 1042968263_1042968264

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1042968263 1042968264
Species Human (GRCh38) Human (GRCh38)
Location 8:74379146-74379168 8:74379168-74379190
Sequence CCGACTCAGGCTTTTTGAGGGCA AGTTCCAACTTTCAAATATGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 19, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!