ID: 1043048080_1043048089

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1043048080 1043048089
Species Human (GRCh38) Human (GRCh38)
Location 8:75352552-75352574 8:75352579-75352601
Sequence CCTGCCCACCACCTGTTCCTCCC TTACCACAGCTGATGCTCTCTGG
Strand - +
Off-target summary {0: 11, 1: 30, 2: 84, 3: 248, 4: 921} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!