ID: 1043074932_1043074935

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1043074932 1043074935
Species Human (GRCh38) Human (GRCh38)
Location 8:75686273-75686295 8:75686326-75686348
Sequence CCAGGCTTGGTTTTAAGTGTTTT TGATTGGTATTATTCATGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 2, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!