ID: 1043172711_1043172716

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1043172711 1043172716
Species Human (GRCh38) Human (GRCh38)
Location 8:76985686-76985708 8:76985708-76985730
Sequence CCTTTAAAAAGCCAATACCCTAA ACAGAAAGAATAGTTACTGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 23, 4: 343}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!