ID: 1043214874_1043214885

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1043214874 1043214885
Species Human (GRCh38) Human (GRCh38)
Location 8:77573606-77573628 8:77573652-77573674
Sequence CCCCTGGCAGCAGCCATGTAGCA AAGGAGAGCAAAGTGATTGTGGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 11, 3: 53, 4: 290} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!