ID: 1043298505_1043298507

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1043298505 1043298507
Species Human (GRCh38) Human (GRCh38)
Location 8:78697417-78697439 8:78697437-78697459
Sequence CCGCACTTAAAAAGTCAAATTCT TCTCCTGGAACTGCATCATCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 412} {0: 1, 1: 0, 2: 0, 3: 16, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!