ID: 1043326195_1043326200

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1043326195 1043326200
Species Human (GRCh38) Human (GRCh38)
Location 8:79054882-79054904 8:79054928-79054950
Sequence CCCAGACTCAGGTTACCTTGCTC CAGTGCCTTTCCCATTATCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 145} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!