ID: 1043378562_1043378569

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1043378562 1043378569
Species Human (GRCh38) Human (GRCh38)
Location 8:79678074-79678096 8:79678102-79678124
Sequence CCTTTCCCCTTTCCAGGTTTTGC ATTGGGCAGCGATCACTCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 521} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!