ID: 1043388099_1043388107

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1043388099 1043388107
Species Human (GRCh38) Human (GRCh38)
Location 8:79767838-79767860 8:79767854-79767876
Sequence CCTGGGGAGGGCGGGGGAGTGGG GAGTGGGGAAGGCGGGCGAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 145, 4: 1190} {0: 1, 1: 0, 2: 2, 3: 64, 4: 748}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!