ID: 1043390892_1043390894

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1043390892 1043390894
Species Human (GRCh38) Human (GRCh38)
Location 8:79790639-79790661 8:79790665-79790687
Sequence CCTTGGTTCATTTGAGTAGGCCT GACAAAGTAAGAAAAAACATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 87} {0: 1, 1: 2, 2: 3, 3: 91, 4: 903}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!