ID: 1043390892_1043390896

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1043390892 1043390896
Species Human (GRCh38) Human (GRCh38)
Location 8:79790639-79790661 8:79790670-79790692
Sequence CCTTGGTTCATTTGAGTAGGCCT AGTAAGAAAAAACATCGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 87} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!