ID: 1043428449_1043428459

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1043428449 1043428459
Species Human (GRCh38) Human (GRCh38)
Location 8:80171519-80171541 8:80171562-80171584
Sequence CCGCGCAGAGCTCCTCCTCGCCT GTCCCCACCCCCAGAGGCGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 406} {0: 1, 1: 0, 2: 0, 3: 26, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!