ID: 1043428452_1043428470

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1043428452 1043428470
Species Human (GRCh38) Human (GRCh38)
Location 8:80171534-80171556 8:80171587-80171609
Sequence CCTCGCCTCCGCCGGCGACTCCC GCGGCGGCGCCGCCCGCCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 342} {0: 1, 1: 0, 2: 3, 3: 37, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!