ID: 1043429971_1043429974

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1043429971 1043429974
Species Human (GRCh38) Human (GRCh38)
Location 8:80185189-80185211 8:80185240-80185262
Sequence CCTGGGCGACAGAGCAAGATTCT CTGAATATACAAATGGACATTGG
Strand - +
Off-target summary No data {0: 2, 1: 18, 2: 48, 3: 88, 4: 333}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!