ID: 1043464039_1043464046

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1043464039 1043464046
Species Human (GRCh38) Human (GRCh38)
Location 8:80487227-80487249 8:80487241-80487263
Sequence CCGCGGCCGCCCCGAGACCTCGG AGACCTCGGTGTGGCCCTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 286} {0: 1, 1: 0, 2: 3, 3: 5, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!