ID: 1043476790_1043476795

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1043476790 1043476795
Species Human (GRCh38) Human (GRCh38)
Location 8:80613121-80613143 8:80613156-80613178
Sequence CCAAATTTGGCCACATCCCATAT TCAGAGCCAGAGCCAACTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 119} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!