ID: 1043601265_1043601278

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1043601265 1043601278
Species Human (GRCh38) Human (GRCh38)
Location 8:81941200-81941222 8:81941230-81941252
Sequence CCACCACCACCACATTCACCTTG GGGTACAGGAGTAAGTAGGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 25, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!