ID: 1043603976_1043603983

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1043603976 1043603983
Species Human (GRCh38) Human (GRCh38)
Location 8:81976873-81976895 8:81976917-81976939
Sequence CCTAACAATATCAACCACTGTAC GATAGTTCTTAAATCAGAGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!