ID: 1043611975_1043611980

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1043611975 1043611980
Species Human (GRCh38) Human (GRCh38)
Location 8:82076158-82076180 8:82076196-82076218
Sequence CCATTTTGTATATGGTCAATTGT AATTTTTATTTATTATAAATGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 14, 3: 280, 4: 2926}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!