ID: 1043666807_1043666821

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1043666807 1043666821
Species Human (GRCh38) Human (GRCh38)
Location 8:82825372-82825394 8:82825407-82825429
Sequence CCTGGGCCCATCTGGACTTTGGG CCTGGGGGTGATGGGTGGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 10, 3: 111, 4: 883}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!