ID: 1043694661_1043694665

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1043694661 1043694665
Species Human (GRCh38) Human (GRCh38)
Location 8:83203860-83203882 8:83203887-83203909
Sequence CCTAGAGACTTGTCGAATGACTT CAAAATGCTGATGGTGATATGGG
Strand - +
Off-target summary No data {0: 1, 1: 45, 2: 79, 3: 84, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!