ID: 1043720095_1043720097

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1043720095 1043720097
Species Human (GRCh38) Human (GRCh38)
Location 8:83537148-83537170 8:83537161-83537183
Sequence CCAGTAATCTGTCATTTGTTCTC ATTTGTTCTCCTATTTCCTTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 15, 4: 225} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!