ID: 1043925104_1043925108

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1043925104 1043925108
Species Human (GRCh38) Human (GRCh38)
Location 8:86027878-86027900 8:86027908-86027930
Sequence CCGTACTGCTACTTGTCTCATCC CTGCTGAGGAACCACAACATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 139} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!