ID: 1043928707_1043928711

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1043928707 1043928711
Species Human (GRCh38) Human (GRCh38)
Location 8:86066496-86066518 8:86066525-86066547
Sequence CCTGGACTTCATTTTAATAAAAC TAGCTAAGGATGACAGAGAATGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 22, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!